Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircSMARCA5 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Glioblastoma | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
DBLink | Link to database | PMID | 29415469 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | GBM biopsies from five fresh-frozen (training set) and fifty-six FFPE (test set) sample with adjacent normal tissue |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACAATGGATACAGAGTCAAGTGTT ReverseCCACAAGCCTCCCTTTTGTTTT | Statistics | Fold Change : Downregulated pvalue : p<0.0001 |
Citation | |||
Barbagallo, D, Caponnetto, A, Cirnigliaro, M, Brex, D, Barbagallo, C, D'Angeli, F, Morrone, A, Caltabiano, R, Barbagallo, GM, Ragusa, M, Di Pietro, C, Hansen, TB, Purrello, M (2018). CircSMARCA5 Inhibits Migration of Glioblastoma Multiforme Cells by Regulating a Molecular Axis Involving Splicing Factors SRSF1/SRSF3/PTB. Int J Mol Sci, 19, 2:no page given. |